chr3:46414947:GTCAGTATCAATTCTGGAAGAATTTCCAGACA> Detail (hg19) (CCR5, CCR5AS)
Information
Genome
| Assembly | Position |
|---|---|
| hg19 | chr3:46,414,947-46,414,978 |
| hg38 | chr3:46,373,456-46,373,487 |
HGVS
| Type | Transcript | Protein |
|---|---|---|
| RefSeq | NM_000579.3:c.554_585delGTCAGTATCAATTCTGGAAGAATTTCCAGACA | NP_000570.1:p.Ser185IlefsTer32 |
| NM_001100168.1:c.554_585delGTCAGTATCAATTCTGGAAGAATTTCCAGACA | NP_001093638.1:p.Ser185IlefsTer32 | |
| Ensemble | ENST00000292303.5:c.554_585delGTCAGTATCAATTCTGGAAGAATTTCCAGACA | ENST00000292303.5:p.Ser185IlefsTer32 |
Summary
MGeND
| Clinical significance | |
| Variant entry | |
| GWAS entry | |
| Disease area statistics | Show details |
Frequency
| JP | HGVD:[No Data.] |
| ToMMo:<0.001 | |
| NCBN:[No Data.] | |
| NCBN(Hondo):[No Data.] | |
| NCBN(Ryukyu):[No Data.] | |
| East asia | ExAC:<0.001 |
Prediction
ClinVar
| Clinical Significance |
|
| Review star | ![]() |
| Show details | |
Disease area statistics
[No Data.]
MGeND
[No Data.]
ClinVar
| Clinical significance | Last evaluated | Review status | Condition | Origin | Links |
|---|---|---|---|---|---|
|
|
2008-12-01 | no assertion criteria provided | Susceptibility to HIV infection |
|
Detail |
|
|
2008-12-01 | no assertion criteria provided | West Nile virus, susceptibility to |
|
Detail |
|
|
2008-12-01 | no assertion criteria provided | Resistance to hepatitis C virus |
|
Detail |
|
|
2008-12-01 | no assertion criteria provided | Multiple sclerosis modifier of disease progression |
|
Detail |
|
|
2019-11-22 | criteria provided, single submitter | not provided |
|
Detail |
|
|
2019-05-10 | criteria provided, single submitter | CCR5-related disorder |
|
Detail |
CIViC
[No Data.]
DisGeNET
| Score | Disease name | Description | Source | Pubmed | Links |
|---|---|---|---|---|---|
| 0.001 | vascular disease occlusive | All subjects were genotyped for 13 polymorphic variants in the genes of xenobiot... | BeFree | 23107763 | Detail |
| 0.337 | hyperhomocysteinemia | All subjects were genotyped for 13 polymorphic variants in the genes of xenobiot... | BeFree | 23107763 | Detail |
| <0.001 | hyperhomocysteinemia | All subjects were genotyped for 13 polymorphic variants in the genes of xenobiot... | BeFree | 23107763 | Detail |
| 0.146 | Homocysteinemia | All subjects were genotyped for 13 polymorphic variants in the genes of xenobiot... | BeFree | 23107763 | Detail |
| <0.001 | Homocysteinemia | All subjects were genotyped for 13 polymorphic variants in the genes of xenobiot... | BeFree | 23107763 | Detail |
Annotation
Annotations
| Descrption | Source | Links |
|---|---|---|
| NM_001394783.1(CCR5):c.554_585del (p.Ser185fs) AND Susceptibility to HIV infection | ClinVar | Detail |
| NM_001394783.1(CCR5):c.554_585del (p.Ser185fs) AND West Nile virus, susceptibility to | ClinVar | Detail |
| NM_001394783.1(CCR5):c.554_585del (p.Ser185fs) AND Resistance to hepatitis C virus | ClinVar | Detail |
| NM_001394783.1(CCR5):c.554_585del (p.Ser185fs) AND Multiple sclerosis modifier of disease progressio... | ClinVar | Detail |
| NM_001394783.1(CCR5):c.554_585del (p.Ser185fs) AND not provided | ClinVar | Detail |
| NM_001394783.1(CCR5):c.554_585del (p.Ser185fs) AND CCR5-related disorder | ClinVar | Detail |
| All subjects were genotyped for 13 polymorphic variants in the genes of xenobiotics detoxification C... | DisGeNET | Detail |
| All subjects were genotyped for 13 polymorphic variants in the genes of xenobiotics detoxification C... | DisGeNET | Detail |
| All subjects were genotyped for 13 polymorphic variants in the genes of xenobiotics detoxification C... | DisGeNET | Detail |
| All subjects were genotyped for 13 polymorphic variants in the genes of xenobiotics detoxification C... | DisGeNET | Detail |
| All subjects were genotyped for 13 polymorphic variants in the genes of xenobiotics detoxification C... | DisGeNET | Detail |
Overlapped Transcript Coordinates
| Gene | Transcript ID | Exon Number | Chromosome | Start | Stop | Type | Amino Mutation | Transcript Position | Links |
|---|
Overlapped Transcript
| Gene | Transcript ID | Chromosome | Start | Stop | Links |
|---|
- Gene
- -
- dbSNP
- rs333 dbSNP
- Genome
- hg19
- Position
- chr3:46,414,947-46,414,978
- Variant Type
- snv
- Reference Allele
- GTCAGTATCAATTCTGGAAGAATTTCCAGACA
- Alternative Allele
- -
- ToMMo VCF FILTER column value (ToMMo 8.3KJPN Allele Frequency Panel(v20200831))
- PASS
- Total VCF ID column value (ToMMo 8.3KJPN Allele Frequency Panel(v20200831))
- rs333
- Allele frequency, for each ALT allele (ToMMo 8.3KJPN Allele Frequency Panel(v20200831))
- 0.0001
- Allele count in genotypes, for each ALT allele (ToMMo 8.3KJPN Allele Frequency Panel(v20200831))
- 2
- Total number of alleles in called genotypes (ToMMo 8.3KJPN Allele Frequency Panel(v20200831))
- 16760
- East Asian Chromosome Counts (ExAC)
- 8652
- East Asian Allele Counts (ExAC)
- 2
- East Asian Heterozygous Counts (ExAC)
- 2
- East Asian Homozygous Counts (ExAC)
- 0
- East Asian Allele Frequency (ExAC)
- 2.311604253351826E-4
- Chromosome Counts in All Race (ExAC)
- 121234
- Allele Counts in All Race (ExAC)
- 8805
- Heterozygous Counts in All Race (ExAC)
- 8005
- Homozygous Counts in All Race (ExAC)
- 400
- Allele Frequency in All Race (ExAC)
- 0.07262814062061798
Genome browser
