chr17:41246335:ATTCAGACTCCCCATCATGTGAGTCATCAGAACCTAACAG> Detail (hg19) (BRCA1)
Information
Genome
| Assembly | Position |
|---|---|
| hg19 | chr17:41,246,335-41,246,374 |
| hg38 | chr17:43,094,318-43,094,357 |
HGVS
| Type | Transcript | Protein |
|---|---|---|
| RefSeq | NM_007300.3:c.1174_1213delCTGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAAT | NP_009231.2:p.Leu392GlnfsTer5 |
| NM_007294.3:c.1174_1213delCTGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAAT | NP_009225.1:p.Leu392GlnfsTer5 | |
| NM_007297.3:c.1033_1072delCTGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAAT | NP_009228.2:p.Leu345GlnfsTer5 |
Summary
MGeND
| Clinical significance | |
| Variant entry | |
| GWAS entry | |
| Disease area statistics | Show details |
Frequency
| JP | HGVD:[No Data.] |
| ToMMo:[No Data.] | |
| NCBN:[No Data.] | |
| NCBN(Hondo):[No Data.] | |
| NCBN(Ryukyu):[No Data.] | |
| East asia | ExAC:<0.001 |
Prediction
ClinVar
| Clinical Significance |
|
| Review star | ![]() |
| Show details | |
Disease area statistics
[No Data.]
MGeND
[No Data.]
ClinVar
| Clinical significance | Last evaluated | Review status | Condition | Origin | Links |
|---|---|---|---|---|---|
|
|
2016-04-22 | reviewed by expert panel | Breast-ovarian cancer, familial, susceptibility to, 1 |
|
Detail |
|
|
2023-12-31 | criteria provided, multiple submitters, no conflicts | hereditary breast ovarian cancer syndrome |
|
Detail |
|
|
2023-12-04 | criteria provided, multiple submitters, no conflicts | Hereditary cancer-predisposing syndrome |
|
Detail |
|
|
2022-11-18 | criteria provided, multiple submitters, no conflicts | not provided |
|
Detail |
|
|
2018-12-04 | criteria provided, multiple submitters, no conflicts | not specified |
|
Detail |
|
|
no assertion criteria provided |
|
Detail | ||
|
|
2021-04-03 | criteria provided, single submitter | Breast and/or ovarian cancer |
|
Detail |
CIViC
[No Data.]
DisGeNET
| Score | Disease name | Description | Source | Pubmed | Links |
|---|---|---|---|---|---|
| 0.360 | Breast-ovarian cancer, familial, susceptibility to, 1 | NA | CLINVAR | Detail | |
| 0.196 | Breast Cancer, Familial | NA | CLINVAR | Detail | |
| 0.126 | Neoplastic Syndromes, Hereditary | NA | CLINVAR | Detail | |
| 0.420 | Hereditary Breast and Ovarian Cancer Syndrome | NA | CLINVAR | Detail |
Annotation
Annotations
| Descrption | Source | Links |
|---|---|---|
| NM_007294.4(BRCA1):c.1175_1214del (p.Leu392fs) AND Breast-ovarian cancer, familial, susceptibility t... | ClinVar | Detail |
| NM_007294.4(BRCA1):c.1175_1214del (p.Leu392fs) AND Hereditary breast ovarian cancer syndrome | ClinVar | Detail |
| NM_007294.4(BRCA1):c.1175_1214del (p.Leu392fs) AND Hereditary cancer-predisposing syndrome | ClinVar | Detail |
| NM_007294.4(BRCA1):c.1175_1214del (p.Leu392fs) AND not provided | ClinVar | Detail |
| NM_007294.4(BRCA1):c.1175_1214del (p.Leu392fs) AND not specified | ClinVar | Detail |
| NM_007294.4(BRCA1):c.1175_1214del (p.Leu392fs) AND Malignant tumor of breast | ClinVar | Detail |
| NM_007294.4(BRCA1):c.1175_1214del (p.Leu392fs) AND Breast and/or ovarian cancer | ClinVar | Detail |
| NA | DisGeNET | Detail |
| NA | DisGeNET | Detail |
| NA | DisGeNET | Detail |
| NA | DisGeNET | Detail |
Overlapped Transcript Coordinates
| Gene | Transcript ID | Exon Number | Chromosome | Start | Stop | Type | Amino Mutation | Transcript Position | Links |
|---|
Overlapped Transcript
| Gene | Transcript ID | Chromosome | Start | Stop | Links |
|---|
- Gene
- -
- dbSNP
- rs80359874 dbSNP
- Genome
- hg19
- Position
- chr17:41,246,335-41,246,374
- Variant Type
- snv
- Reference Allele
- ATTCAGACTCCCCATCATGTGAGTCATCAGAACCTAACAG
- Alternative Allele
- -
- East Asian Chromosome Counts (ExAC)
- 8654
- East Asian Allele Counts (ExAC)
- 0
- East Asian Heterozygous Counts (ExAC)
- 0
- East Asian Homozygous Counts (ExAC)
- 0
- East Asian Allele Frequency (ExAC)
- 0.0
- Chromosome Counts in All Race (ExAC)
- 121238
- Allele Counts in All Race (ExAC)
- 1
- Heterozygous Counts in All Race (ExAC)
- 1
- Homozygous Counts in All Race (ExAC)
- 0
- Allele Frequency in All Race (ExAC)
- 8.248239000973292E-6
Genome browser
