chr6:31902068:GTGGACAGGGTCAGGAATCAGGAGTCTG> Detail (hg19) (C2)
Information
Genome
| Assembly | Position |
|---|---|
| hg19 | chr6:31,902,068-31,902,095 |
| hg38 | chr6:31,934,291-31,934,318 |
HGVS
| Type | Transcript | Protein |
|---|---|---|
| RefSeq | NM_000063.5:c.841_849+19delGTGGACAGGGTCAGGAATCAGGAGTCTG | NP_000054.2:p.Val281_Arg283del |
| NM_001282458.1:c.841_849+19delGTGGACAGGGTCAGGAATCAGGAGTCTG | NP_001269387.1:p.Val281_Arg283del | |
| NM_001282459.1:c.841_868delGTGGACAGGGTCAGGAATCAGGAGTCTG | NP_001269388.1:p.Val281ProfsTer110 |
Summary
MGeND
| Clinical significance | |
| Variant entry | |
| GWAS entry | |
| Disease area statistics | Show details |
Frequency
| JP | HGVD:[No Data.] |
| ToMMo:[No Data.] | |
| NCBN:[No Data.] | |
| NCBN(Hondo):[No Data.] | |
| NCBN(Ryukyu):[No Data.] | |
| East asia | ExAC:<0.001 |
Prediction
ClinVar
| Clinical Significance | Conflicting classifications of pathogenicity |
| Review star | ![]() |
| Show details | |
Disease area statistics
[No Data.]
MGeND
[No Data.]
ClinVar
| Clinical significance | Last evaluated | Review status | Condition | Origin | Links |
|---|---|---|---|---|---|
|
|
2024-04-04 | criteria provided, conflicting interpretations | complement component 2 deficiency |
|
Detail |
|
|
2024-02-06 | criteria provided, multiple submitters, no conflicts | not provided |
|
Detail |
|
|
1992-05-05 | no assertion criteria provided | C2 deficiency, type I |
|
Detail |
|
|
2022-04-18 | criteria provided, single submitter | complement component 2 deficiency,age related macular degeneration 14 |
|
Detail |
|
|
2022-04-18 | criteria provided, single submitter | complement component 2 deficiency,age related macular degeneration 14 |
|
Detail |
|
|
2023-12-09 | criteria provided, multiple submitters, no conflicts | C2-related disorder |
|
Detail |
CIViC
[No Data.]
DisGeNET
| Score | Disease name | Description | Source | Pubmed | Links |
|---|---|---|---|---|---|
| 0.360 | complement component 2 deficiency | NA | CLINVAR | Detail |
Annotation
Annotations
| Descrption | Source | Links |
|---|---|---|
| NM_000063.6(C2):c.841_849+19del AND Complement component 2 deficiency | ClinVar | Detail |
| NM_000063.6(C2):c.841_849+19del AND not provided | ClinVar | Detail |
| NM_000063.6(C2):c.841_849+19del AND C2 deficiency, type I | ClinVar | Detail |
| NM_000063.6(C2):c.841_849+19del AND multiple conditions | ClinVar | Detail |
| NM_000063.6(C2):c.841_849+19del AND multiple conditions | ClinVar | Detail |
| NM_000063.6(C2):c.841_849+19del AND C2-related disorder | ClinVar | Detail |
| NA | DisGeNET | Detail |
Overlapped Transcript Coordinates
| Gene | Transcript ID | Exon Number | Chromosome | Start | Stop | Type | Amino Mutation | Transcript Position | Links |
|---|
Overlapped Transcript
| Gene | Transcript ID | Chromosome | Start | Stop | Links |
|---|
- Gene
- -
- dbSNP
- rs9332736 dbSNP
- Genome
- hg19
- Position
- chr6:31,902,068-31,902,095
- Variant Type
- snv
- Reference Allele
- GTGGACAGGGTCAGGAATCAGGAGTCTG
- Alternative Allele
- -
- East Asian Chromosome Counts (ExAC)
- 8640
- East Asian Allele Counts (ExAC)
- 0
- East Asian Heterozygous Counts (ExAC)
- 0
- East Asian Homozygous Counts (ExAC)
- 0
- East Asian Allele Frequency (ExAC)
- 0.0
- Chromosome Counts in All Race (ExAC)
- 121204
- Allele Counts in All Race (ExAC)
- 619
- Heterozygous Counts in All Race (ExAC)
- 617
- Homozygous Counts in All Race (ExAC)
- 1
- Allele Frequency in All Race (ExAC)
- 0.0051070921751757365
Genome browser
